What is wrong with the following piece of mrna taccaggatcactttgcca
Like DNA, RNA is made up of nucleotide consisting of a 5-carbon sugar ribose, a phosphate group, and a nitrogenous base. However, there are three main differences between DNA and RNA: RNA uses the sugar ribose instead of deoxyribose. RNA is generally single-stranded instead of double-stranded. RNA contains uracil in place of thymine.
Most of us are familiar with the term “assertive.” We have a general idea of what being assertive means. B Most of us are familiar with the term “assertive.” We have a general idea...
The Pennsylvania State University. As discussed previously, eukaryotic mRNAs are capped at their 5' end and polyadenylated at their 3' end. In vitro assays for these reactions have been developed, and several of the enzymatic activities have been identified. These will be reviewed in this section. Polyadenylation is not limited to eukaryotes.Messenger RNA 3′ end processing is a well-orchestrated process that involves components of the transcription, the splicing and the translation machinery. The medical importance of 3′ end processing is illustrated by an increasing number of different disease entities, which are caused by inappropriate 3′ end processing. Cells decode mRNAs by reading their nucleotides in groups of three, called codons. Here are some features of codons: Most codons specify an amino acid. Three "stop" codons mark the end of a protein. One "start" codon, AUG, marks the beginning of a protein and also encodes the amino acid methionine. The paper goes into detail on the rise in the number of germinal centers in the draining lymph nodes, the exact location of all that B-cell selection and the corresponding antibody changes, which argues strongly that the antibody improvements mentioned in yesterday's post will occur after mRNA vaccination as well.Authored by Andrew Wakefield and 12 others, the paper's scientific limitations were clear when it appeared in 1998. 2 3 As the ensuing vaccine scare took off, critics quickly pointed out that the paper was a small case series with no controls, linked three common conditions, and relied on parental recall and beliefs. 4 Over the following ...One Piece is a popular anime and manga series created by Eiichiro Oda. It has gained a massive following worldwide, captivating fans with its unique storytelling, memorable charact...When splicing turns bad. RNA splicing, the process that removes introns from pre-mRNA and links exons together to generate the fully mature messenger RNA (mRNA), is a complicated and highly regulated process. Splicing is catalyzed by the spliceosome, a large RNA-protein complex composed of several small nuclear ribonucleoprotein complexes ...
A. Given the following piece of messenger RNA (mRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAG UGGUGCGCC... 1. List the DNA strand sequence from which it was transcribed.Question. Solved step-by-step. What is wrong with the following piece of mRNA? TACCAGGATCACTTTGCCA. It contains too many stop codons. It does not …Figure 10.3.1 10.3. 1: (a) Ribonucleotides contain the pentose sugar ribose instead of the deoxyribose found in deoxyribonucleotides. (b) RNA contains the pyrimidine uracil in place of thymine found in DNA. The RNA-specific pyrimidine uracil forms a complementary base pair with adenine and is used instead of the thymine used in DNA.The mRNA specifies, in triplet code, the amino acid sequence of proteins; the code is then read by transfer RNA (tRNA) molecules in a cell structure called the ribosome. The genetic code is ...What is wrong with the following piece of mrna taccaggatcactttgcca? The given sequence is not a piece of mRNA. mRNA sequences contain the nitrogenous bases adenine (A), cytosine (C), guanine (G), and uracil (U).Abstract. Localization of mRNAs at the subcellular level is an essential mechanism for specific protein targeting and local control of protein synthesis in both eukaryotes and bacteria. While mRNA localization is well documented in metazoans, somatic cells, and microorganisms, only a handful of well-defined mRNA localization examples have been ...The COVID-19 vaccine lessens the severity of COVID-19 by teaching the immune system to recognize and fight the virus that causes the disease. For fall/winter 2023–2024, the updated COVID-19 vaccine is based on the XBB.1.5 variant. The updated vaccine is made by Pfizer-BioNTech, Moderna and Novavax. This season, only one shot of the vaccine is ...
The polymerase checks whether the newly added base has paired correctly with the base in the template strand. If it is the right base, the next nucleotide is added. If an incorrect base has been added, the enzyme makes a cut at the phosphodiester bond and releases the wrong nucleotide. This is performed by the exonuclease action of DNA pol III.The application of messenger RNA in cancer immunotherapy is gaining tremendous popularity as mRNA can function as an effective vector for the delivery of therapeutic antibodies on immune targets. The high efficacy, decreased toxicity, rapid manufacturing and safe administration of mRNA vaccines have great advantages over conventional vaccines.Transcribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA CCC AGC CTA TCC GTC ATT. mRNA: Complete the corresponding DNA strand from the mRNA strand: DNA: mRNA: AUG ACU GCG CCC CGA UCC UGU UAA. Translate the following mRNA sequence into its appropriate amino acid sequence: (abbreviate amino acids by first three letters.The provided mRNA sequence "TACCAGGATCACTTTGCCA" is incorrect due to the presence of thymine (T) instead of uracil (U). So, the correct option is C. So, the correct option is C. Messenger RNA (mRNA) is a crucial molecule in protein synthesis, carrying genetic information from DNA to ribosomes for protein production.
Selah cliffs fire.
Study with Quizlet and memorize flashcards containing terms like What is wrong with the following piece of mRNA? TACCAGGATCACTTTGCCA, Each mRNA 3-base sequence, called a _____ , matches with a tRNA sequence called the _____ . The tRNA also carries the specified _____ , used as a building block for a protein., The RNA product of the genetic code above has the sequence _____ It binds to the ...mRNA vaccines work by introducing a piece of mRNA that corresponds to a viral protein, usually a small piece of a protein found on the virus’s outer membrane. (Individuals who get an mRNA vaccine are not exposed to the virus, nor can they become infected with the virus by the vaccine.) By using this mRNA, cells can produce the viral protein.The wrong with following piece of mRNA, TACCAGGATCACTTTGCCA is that it contains T and not U. So, option(D) is right choice here. Messenger RNA (mRNA) is present in DNA. DNA uses four bases in its code, adenine (A), guanine (G), cytosine (C) and thymine (T). RNA also uses four bases.Apr 21, 2021 · The mRNA vaccine platform mRNA or messenger RNA, vaccines teach the immune system to make memory cells. So that if you are exposed to the virus at a future date, the immune system has the ability to rev up production of antibodies rapidly and fight off the pathogen again. An mRNA vaccine is a copy of the genetic code used by the SARS-CoV-2 ... RNA molecules carry amino acids to growing proteins. Mutations that occur in the DNA are transcribed into the RNA. RNA is the intermediary between DNA and proteins. Scientific Literacy - Chapter 7. Read the following abstract and then answer the question that follows. Diet and exercise greatly affect the body.Jun 15, 2019 · As elongation proceeds, the DNA is continuously unwound ahead of the core enzyme and rewound behind it (Figure 9.3.1 9.3. 1 ). Figure 9.3.1 9.3. 1: During elongation, the bacterial RNA polymerase tracks along the DNA template, synthesizes mRNA in the 5’ to 3’ direction, and unwinds and rewinds the DNA as it is read.
Claim: COVID-19 mRNA vaccines will become deadly a few months after administration because the antibodies they create have been shown to cause deadly immune reactions resulting in damage to the ...Jul 21, 2022 · Intron Processing. All introns in a pre-mRNA must be completely and precisely removed before protein synthesis. If the process errs by even a single nucleotide, the reading frame of the rejoined exons would shift, and the resulting protein would be dysfunctional. The process of removing introns and reconnecting exons is called splicing. The three types of RNA are found in different locations. mRNA is made in the nucleus, with each mRNA fragment copied from its relative piece of DNA, before leaving the nucleus and entering the cytoplasm. The fragments are then shuttled around the cell as needed, moved along by the cell's internal transport system, the cytoskeleton. tRNA, like ...Debunking mRNA Vaccine Misconceptions—An Overview for Medical Professionals. The hearts and minds of people worldwide have been consumed by the life-altering consequences of the Coronavirus disease 2019 (COVID-19) pandemic. Vaccine development is a cornerstone of the world's return to normalcy, and 2 mRNA-based …Following transcriptional inhibition, time points were taken and at each interval both protein and mRNA levels were monitored. Importantly, the effect of each distinct miRNA was measured in this manner. In all three cases, the Green lab observed that translational repression always occurred before mRNA degradation.Key Points. mRNA vaccines inject cells with instructions to generate a protein that is normally found on the surface of SARS-CoV-2, the virus that causes COVID-19. The protein that the person makes in response to the vaccine can cause an immune response without a person ever having been exposed to the virus that causes COVID-19.Publisher Summary. This chapter focuses on the history of the discovery of cap and an update of research on viral and cellular-messenger RNA (mRNA) capping. Cap structures of the type m 7 GpppN (m)pN (m)p are present at the 5′ ends of nearly all eukaryotic cellular and viral mRNAs. A cap is added to cellular mRNA precursors and to the ...Not mRNA vaccines. Instead, mRNA vaccines use mRNA created in a laboratory to teach our cells how to make a protein — or even just a piece of a protein — that triggers an immune response inside our bodies. This immune response, which produces antibodies, is what helps protect us from getting sick from that germ in the future.".Just as the cell’s genome describes its full complement of DNA, a cell’s proteome is its full complement of proteins. Protein synthesis begins with genes. A gene is a functional segment of DNA that provides the genetic information necessary to build a protein. Each particular gene provides the code necessary to construct a particular protein.
The rapid development of effective mRNA vaccines for COVID-19 has led some observers to suggest that mRNA will push other types of vaccines out of the market completely in the near future. Here, experts Jennifer Pancorbo, Gary Gilleskie, and Matt Koci, all of North Carolina State University, dig into mRNA vaccines and their place in …
Two COVID-19 vaccines — Pfizer and Moderna — use messenger RNA (mRNA) technology. mRNA is a molecule that acts like a blueprint to make specific proteins in your body. mRNA COVID vaccines are different from traditional vaccines, such as flu shots. They don’t need to introduce live or inactivated viruses or bacteria into the body to …What is wrong with the following piece of mRNA? TACCAGGATCACTTTGCCA. It contains T and not U. The nucleotide sequence in mRNA is determined by. the nucleotide sequence of DNA. Complete the sentence: if the nucleotides ATT were inserted into the template strand of a gene, then.Adenine (A) Cytosine (C) Uracil (U) Guanine (G) Uracil is a pyrimidine structurally analogous to thymine, another pyrimidine found in DNA. Thymine is replaced …Detailed analyses with head-to-head comparison of the T-cell response following mRNA vaccine or inactivated whole-virus vaccines are however lacking. One study reported a different spectrum of T-cell responses (in terms of epitopes and IFN-γ-positive T-cell response) between BNT162b2 and BBIBP-CorV (inactivated virus) but it was concluded that ...What acts as a connector to help convert the nucleotide sequence of mRNA into the amino acid sequence of a polypeptide during translation? tRNA What is wrong with the …All nuclear-encoded eukaryotic messenger RNAs possess a 5' cap structure (m7GpppN) and, with a few exceptions, alsPreisso a 3' poly(A) tail. These modifications are added as part of the mRNA processing pathway during or immediately after transcription in the nucleus. Subsequently, they both influence different aspects of mRNA metabolism including splicing, transport, stability and translation ...Upon intramuscular injection, the vaccine mRNA is taken up by muscle and immune cells, and transported to the regional lymph nodes and concentrated in the spleen . The vaccines consist of nonreplicating mRNA and are expected to naturally decompose both within the cytosol after translation and at the injection site.
Wheel of fortune april 11 2023.
Brian wells documentary.
The complete set of correspondences between codons and amino acids (or stop signals) is known as the genetic code. _Image credit: " The genetic code ," by OpenStax College, Biology ( CC BY 3.0 )._. In the rest of this article, we'll more closely at the genetic code. First, we'll see how it was discovered.Following the development of this method, the use of reverse transcriptase to clone expressed genes grew for several decades. However, there were limits to this practice. However, there were ...Oct 19, 2021 · What is wrong with the following piece of mRNA? TACCAGGATCACTTTGCCA 22 Multiple Choice eBook References It does not include an equal number of As and Ts. It does not include an equal number of Gs and Cs. It contains one "U" instead of "T". It contains too many stop codons. Publisher Summary. This chapter focuses on the history of the discovery of cap and an update of research on viral and cellular-messenger RNA (mRNA) capping. Cap structures of the type m 7 GpppN (m)pN (m)p are present at the 5′ ends of nearly all eukaryotic cellular and viral mRNAs. A cap is added to cellular mRNA precursors and to the ...Jun 29, 2021 · mRNA Vaccines. Vaccines are of course aimed at producing a durable immune response - you have a short series of injections to achieve this, and then the memory functions of the immune system take over for lasting protection. Immunizing against some sort of foreign protein found in a dangerous virus or bacterium is the most obvious way to work ... Specifically, we observed a high level of SARS-CoV-2-specific Ab-secreting cells in the bone marrow of mice immunized 9 weeks earlier with SARS-CoV-2 mRNA vaccines. Because of the location and time point of analysis, these data were indicative of the successful generation of LLPCs following the GC reactions.Study with Quizlet and memorize flashcards containing terms like Select the true statements: 1. All mutations are harmful to the organism's genome. 2. Mutagens and meiosis are two sources of mutation. 3. A single-base insertion is usually more harmful than a single-base substitution. 4. Insertions, but not deletions, can change the codon reading frame.Inactivated vaccines are another form of vaccine, where the virus is inactivated during the process of making the vaccine. Inactivated vaccines are not strongly influenced by antibodies in the ...The early years of mRNA research were marked by a lot of enthusiasm for the technology but some difficult technical challenges that took a great deal of innovation to overcome. The biggest challenge was that mRNA would be taken up by the body and quickly degraded before it could "deliver" its message—the RNA transcript—and be read into ...Abstract. Abnormal immune cell functions are commonly related to various diseases, including cancer, autoimmune diseases, and infectious diseases. Messenger RNA (mRNA)-based therapy can regulate the functions of immune cells or assign new functions to immune cells, thereby generating therapeutic immune responses to treat these diseases.Transcription overview. Transcription is the first step of gene expression. During this process, the DNA sequence of a gene is copied into RNA. Before transcription can take place, the DNA double helix must unwind near the gene that is getting transcribed. The region of opened-up DNA is called a transcription bubble. ….
Definition. Ribonucleic acid (abbreviated RNA) is a nucleic acid present in all living cells that has structural similarities to DNA. Unlike DNA, however, RNA is most often single-stranded. An RNA molecule has a backbone made of alternating phosphate groups and the sugar ribose, rather than the deoxyribose found in DNA.Feb 2, 2024 · It lasts longer than mRNA, but it doesn’t amplify forever. Japan approved the new vaccine, called LUNAR-COV19, in late November on the basis of results from a 16,000-person trial in Vietnam ... Driving in the fog can be dangerous, but common sense can help keep you safe. Read about 5 completely wrong ways to drive in the fog. Advertisement Fog is one of those driving haza...Hint: In transcription, the DNA sequence of the gene is "rephrased" in RNA.In eukaryotic cells, the RNA has to go through additional processing stages for becoming an RNA or messenger RNA. Complete answer: The mRNA is a single-stranded RNA molecule that correlates to the genetic sequence of genes and is translated by a ribosome in the phase of protein biosynthesis. Study with Quizlet and memorize flashcards containing terms like a typo in a recipe, It contains T and not U, transcription, mRNA, nucleus and more. 1. Introduction. Two mRNA vaccines, BNT162b2 (Pfizer-BioNTech) and mRNA-1273 (Moderna) have been widely used to combat the COVID-19 pandemic , .By late May 2021, a higher than expected number of myocarditis reports following mRNA vaccination were submitted to the United States (US) Vaccine Adverse Event Reporting System (VAERS), particularly among young males after dose 2, suggesting an ...The problem with the following piece of mRNA, TACCAGGATCACTTTGCCA, is option d: It contains T and not U. In the process of transcription, which generates mRNA, the DNA base T (Thymine) is replaced by mRNA's base U (Uracil). So, in a properly transcribed piece of mRNA, you would not find any Ts, they would all be replaced by Us.Here’s the best way to solve it. Last option is correct …. What is wrong with the following place of mRNA? TACCAGGATCACTTTGCCA It contains too many stop codons. It does not Include an equal number of Gs and Cs It contains A It does not include an equal number of As and Ts It contains T and not U.Even after the billions of doses given during the pandemic, messenger RNA (mRNA) vaccines still hold surprises. A study out today reveals they may unexpectedly prompt cells to produce small amounts of unintended proteins. There is no evidence that these mistakes compromise the safety of the COVID-19 vaccines, which saved millions of lives, and ... What is wrong with the following piece of mrna taccaggatcactttgcca, After you get an mRNA COVID-19 vaccine, your muscle cells begin making the protein pieces and displaying them on cell surfaces. The immune system recognizes the protein and begins building an immune response and making antibodies. After delivering instructions, the mRNA is immediately broken down., To ascertain mRNA positioning and the fidelity of translation initiation, the start codon is usually adjacent to a characteristic pattern of bases named Kozak sequence ((A/G)CCAUGG) that might serve to slow mRNA scanning and favour start codon recognition. While this pattern makes one think of SD sequence, it does not involve base-pairing with ..., Background: Our near-real-time safety monitoring of 16 adverse events (AEs) following COVID-19 mRNA vaccination identified potential elevation in risk for six AEs following primary series and monovalent booster dose administration. The crude association with AEs does not imply causality. Accordingly, we conducted robust evaluation of potential associations., Forgot Password? Enter your Username (NOT your full email) and we'll send you a link to change your password., Pre-mRNA splicing involves the precise removal of introns from the primary RNA transcript. The splicing process is catalyzed by protein complexes called spliceosomes that are composed of proteins and RNA molecules called snRNAs. Spliceosomes recognize sequences at the 5′ and 3′ end of the intron. Errors in splicing are implicated in cancers ..., The provided mRNA sequence is TACCAGGATCACTTTGCCA. In RNA, the bases are represented by letters: A for adenine, U for uracil, G for guanine , and C for cytosine. RNA molecules are single-stranded, and their sequence is crucial for the production of proteins during translation., Like DNA, RNA is made up of nucleotide consisting of a 5-carbon sugar ribose, a phosphate group, and a nitrogenous base. However, there are three main differences between DNA and RNA: RNA uses the sugar ribose instead of deoxyribose. RNA is generally single-stranded instead of double-stranded. RNA contains uracil in place of thymine., Abstract. The 5′ m7G cap is an evolutionarily conserved modification of eukaryotic mRNA. Decades of research have established that the m7G cap serves as a unique molecular module that recruits cellular proteins and mediates cap-related biological functions such as pre-mRNA processing, nuclear export and cap-dependent protein …, DNA. What part of the phage did Hershey and Chase label with radioactive 32P? protein. Experimental phage. In the Hershey and Chase experiment, the phage used consisted of a DNA molecule surrounded by a ______ coat. nucleotide sequence in DNA. The nucleotide sequence in mRNA is determined by the. False. True or False., mRNA never enters the nucleus of the cell, which is where our DNA (genetic material) is kept. The cell breaks down the mRNA soon after it is finished using the mRNA's instructions to make the viral protein that will trigger the body to make antibodies against the virus. Learn more about . mRNA vaccines . from CDC. What are the side effects of ..., Study with Quizlet and memorize flashcards containing terms like What is wrong with the following piece of mRNA? TACCAGGATCACTTTGCCA, Each mRNA 3-base sequence, called a _____ , matches with a tRNA sequence called the _____ ., Splicing errors and disease. The division of eukaryotic genes into exons and introns has clear evolutionary advantages, including regulatory, mutation buffering and coding capacity benefits 12.However, this split gene architecture introduces a requirement for an intricate splicing regulatory network that consists of an array of RNA regulatory sequences, RNA-protein complexes and splicing ..., This impacts the processing of the mRNA and subsequent protein produced. Explanation: The problem in the given piece of mRNA, TACCAGGATCACTTTGCCA, is that it contains T and not U. In mRNA sequences, uracil (U) is used instead of thymine (T) found in DNA. Each nucleotide in the mRNA corresponds to a specific amino acid in a process called ..., 2. mRNA cap modifications. In mammals, the predominant cap structure is 7-methylguanosine linked via a 5′ to 5′ triphosphate bridge to the first transcribed nucleotide, which is methylated on the ribose O-2 position (denoted m7G(5′)ppp(5′)Xm, X is the first transcribed nucleotide) [2,5] Fig. 1. m7G(5′)ppp(5′)Xm was initially presumed to be present on all mRNA, however, due to ..., The advantage of RNA-based vaccines is their potential for rapid development and reduced side effects. mRNA-based vaccines avoid the risk of integration with the host cell genome and are able to produce pure viral protein. mRNA is transiently expre ssed, therefore allowing protein to be made within the cell. ., It lasts longer than mRNA, but it doesn’t amplify forever. Japan approved the new vaccine, called LUNAR-COV19, in late November on the basis of results from a 16,000-person trial in Vietnam ..., Errors in translation decoding are regulated by tRNA wobbling at all three codon positions. Sixty-four tRNA sets are summarized and specified in parallel with codon degeneracy (left bottom and central). Faithful or misincorporated protein can result from decoding by cognate or near-cognate tRNA at position 3., Both clinical trials and real-world studies investigating the capabilities of mRNA COVID-19 vaccines have shown enormous efficacy. The likelihood of contracting COVID-19 if you've been fully vaccinated with an mRNA vaccine is less than 10 percent, Weissman said. And the latest data says that if you do catch COVID-19, your symptoms will not be ..., The nucleotide sequence in mRNA is determined by the nucleotide sequence in DNA. Choose the option below that contains the correct complementary DNA sequence to the following: 5' - AAGTCATTGCCGTA - 3' , The most frequently reported appreciable symptoms were injection site symptoms (30.3%), followed by reports of fatigue or malaise (11.2%). There were no reports of acute bleeding, thrombotic events or severe allergic and/or anaphylactic reactions during or after vaccine administration., mRNA never enters the nucleus of the cell, which is where our DNA (genetic material) is kept. The cell breaks down the mRNA soon after it is finished using the mRNA’s …, Question: What is wrong with the following piece of mRNA? TACCAGGATCACTTTGCCAMultiple ChoiceIt does not include an equal number of Gs and Cs.It contains A and not U.It does not include an equal number of As and Ts.It contains T and not U.It contains too many stop codons., The rapid development of effective mRNA vaccines for COVID-19 has led some observers to suggest that mRNA will push other types of vaccines out of the market completely in the near future. Here, experts Jennifer Pancorbo, Gary Gilleskie, and Matt Koci, all of North Carolina State University, dig into mRNA vaccines and their place in …, DNA vs. RNA. DNA and RNA are very similar. After all, RNA is supposed to be a copy of DNA. However, there are a few differences between the two molecules. The biggest difference is in their shape: DNA is a two-stranded molecule in the form of a double helix. RNA, on the other hand, is a single-stranded molecule., Basically, a gene is used to build a protein in a two-step process: Step 1: transcription! Here, the DNA sequence of a gene is "rewritten" in the form of RNA. In eukaryotes like you and me, the RNA is processed (and often has a few bits snipped out of it) to make the final product, called a messenger RNA or mRNA., What is wrong with the following piece of mRNA? TACCAGGATCACTTTGCCA. Click the card to flip. It contains T and not U., Abstract. Messenger RNA (mRNA) stability and translational efficiency are two crucial aspects of the post-transcriptional process that profoundly impact protein production in a cell. While it is widely known that ribosomes produce proteins, studies during the past decade have surprisingly revealed that ribosomes also control mRNA stability in a ..., The messenger molecule that’s been in every living cell for billions of years is the key ingredient in some COVID-19 vaccines, a Texas A&M expert explains. mRNA is an important messenger, carrying the instructions for life from DNA to the rest of the cell. One surprising star of the coronavirus pandemic response has been the molecule called mRNA., The advantage of RNA-based vaccines is their potential for rapid development and reduced side effects. mRNA-based vaccines avoid the risk of integration with the host cell genome and are able to produce pure viral protein. mRNA is transiently expre ssed, therefore allowing protein to be made within the cell. ., Template copy numbers decreased with the day of sampling. In plasma, mRNA was immediately detectable at just hours following vaccination, remained detectable when sampled at 6 and 15 days ( Figure 1 A, green), but was below the limit of quantification (LoQ) for one sample at 27 days., Both the Pfizer vaccine and the Moderna vaccine are made using synthetic messenger RNA. Unlike DNA, which carries genetic information for every cell in the human body, messenger RNA directs the ..., A mRNA vaccine contains a genetic code that teaches the body's immune system how to respond to a pathogen. Other vaccines, such as the Shingrix vaccine, contain non-live modified DNA from a virus., Study with Quizlet and memorize flashcards containing terms like What is wrong with the following strand of mRNA? TACCAGGATCACTTTGCCA, Use the DNA template strand below to create a complementary RNA strand. Type the complementary RNA strand in the box, DNA to protein diagram Fill in the diagram below to show the relationship between DNA and proteins. and more.